shrna cassette Search Results


scrambled ineffective shrna cassette  (Shanghai GenePharma)
90
Shanghai GenePharma scrambled ineffective shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Scrambled Ineffective Shrna Cassette, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/scrambled ineffective shrna cassette/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
scrambled ineffective shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
custom mhp_shrna cassette  (GenScript corporation)
90
GenScript corporation custom mhp_shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Custom Mhp Shrna Cassette, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/custom mhp_shrna cassette/product/GenScript corporation
Average 90 stars, based on 1 article reviews
custom mhp_shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
small hairpin rna (shrna) cassette targeting human cldn3  (Ribobio co)
90
Ribobio co small hairpin rna (shrna) cassette targeting human cldn3
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Small Hairpin Rna (Shrna) Cassette Targeting Human Cldn3, supplied by Ribobio co, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/small hairpin rna (shrna) cassette targeting human cldn3/product/Ribobio co
Average 90 stars, based on 1 article reviews
small hairpin rna (shrna) cassette targeting human cldn3 - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
h1-promoter-driven shrna gene cassettes  (VectorBuilder GmbH)
90
VectorBuilder GmbH h1-promoter-driven shrna gene cassettes
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
H1 Promoter Driven Shrna Gene Cassettes, supplied by VectorBuilder GmbH, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/h1-promoter-driven shrna gene cassettes/product/VectorBuilder GmbH
Average 90 stars, based on 1 article reviews
h1-promoter-driven shrna gene cassettes - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
shrna cassettes specifically targeting the nucleotide of phb  (GenScript corporation)
90
GenScript corporation shrna cassettes specifically targeting the nucleotide of phb
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Shrna Cassettes Specifically Targeting The Nucleotide Of Phb, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes specifically targeting the nucleotide of phb/product/GenScript corporation
Average 90 stars, based on 1 article reviews
shrna cassettes specifically targeting the nucleotide of phb - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
mini-mir30 based shrna cassette  (PSICOR Inc)
90
PSICOR Inc mini-mir30 based shrna cassette
The effect <t>of</t> <t>AGO2</t> knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control <t>shRNA</t> by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation
Mini Mir30 Based Shrna Cassette, supplied by PSICOR Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/mini-mir30 based shrna cassette/product/PSICOR Inc
Average 90 stars, based on 1 article reviews
mini-mir30 based shrna cassette - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
lair1 overexpression cassette  (Shanghai Genechem Ltd)
86
Shanghai Genechem Ltd lair1 overexpression cassette
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
Lair1 Overexpression Cassette, supplied by Shanghai Genechem Ltd, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lair1 overexpression cassette/product/Shanghai Genechem Ltd
Average 86 stars, based on 1 article reviews
lair1 overexpression cassette - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)  (Shanghai GenePharma)
90
Shanghai GenePharma pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
Pgphi/Gfp/Neo Plasmid Containing Vegf Shrna Expression Cassette (Target 9 Sequence: Ggagtaccctgatgagatcga), supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga)/product/Shanghai GenePharma
Average 90 stars, based on 1 article reviews
pgphi/gfp/neo plasmid containing vegf shrna expression cassette (target 9 sequence: ggagtaccctgatgagatcga) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)  (GenScript corporation)
90
GenScript corporation three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
Three Different Shrna Cassette Sequences Against The Human Task 3 Gene (Kcnk9; Genbank Accession Number: Nm 016601), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601)/product/GenScript corporation
Average 90 stars, based on 1 article reviews
three different shrna cassette sequences against the human task-3 gene (kcnk9; genbank accession number: nm_016601) - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
shrna cassettes against atm  (Broad Institute Inc)
90
Broad Institute Inc shrna cassettes against atm
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
Shrna Cassettes Against Atm, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes against atm/product/Broad Institute Inc
Average 90 stars, based on 1 article reviews
shrna cassettes against atm - by Bioz Stars, 2026-06
90/100 stars
  Buy from Supplier
u6 promoter shrna cassettes  (Twist Bioscience)
86
Twist Bioscience u6 promoter shrna cassettes
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
U6 Promoter Shrna Cassettes, supplied by Twist Bioscience, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/u6 promoter shrna cassettes/product/Twist Bioscience
Average 86 stars, based on 1 article reviews
u6 promoter shrna cassettes - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier
shrna cassettes  (Merck & Co)
86
Merck & Co shrna cassettes
Bioinformatic analysis of <t>LAIR1</t> expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.
Shrna Cassettes, supplied by Merck & Co, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/shrna cassettes/product/Merck & Co
Average 86 stars, based on 1 article reviews
shrna cassettes - by Bioz Stars, 2026-06
86/100 stars
  Buy from Supplier

Image Search Results


The effect of AGO2 knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control shRNA by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation

Journal: BMC Cancer

Article Title: Argonaute 2 and nasopharyngeal carcinoma: a genetic association study and functional analysis

doi: 10.1186/s12885-015-1895-4

Figure Lengend Snippet: The effect of AGO2 knockdown on proliferation, apoptosis and migration of NPC cells. a Confirmation of AGO2 knockdown in CNE2Z cells transfected with AGO2 shRNAs or control shRNA by western blot assay. b Cell proliferation was evaluated by CCK-8 assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA at different time points (24, 48, 72 and 96 h). The experiments were repeated at least three times, and the points represent the mean values of triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (ANOVA test). c Apoptosis was assessed by flow cytometric analysis of annexin V-APC/7-AAD staining in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative flow cytometric analysis are shown ( left panel ). The Annexin V-positive cells were regarded as apoptotic cells. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean values of apoptotic cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). d Cell migration was evaluated by transwell assay in CNE2Z cells transfected with AGO2 shRNAs or control shRNA. Representative results are shown ( left panel ). Magnification: 400 ×. The experiments were repeated at least three times, and the histogram ( right panel ) represents the mean numbers of transferred cells from triplicate tests (mean ± SD). *** P < 0.0001, compared with the controls (Unpaired t test). CCK-8, Cell Counting Kit-8; SD, standard deviation

Article Snippet: The AGO2 specific shRNA expression vectors and the scrambled ineffective shRNA cassette (as the negative control) in the pGPU6/GFP/Neo plasmid were purchased from GenePharma (China).

Techniques: Knockdown, Migration, Transfection, Control, shRNA, Western Blot, CCK-8 Assay, Staining, Transwell Assay, Cell Counting, Standard Deviation

Bioinformatic analysis of LAIR1 expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Bioinformatic analysis of LAIR1 expression in pan-cancer and its prognostic value in GC. (A) LAIR1 expression across cancers from TIMER2. (B-D) Poor prognosis associated with high LAIR1 expression (probe 208071_s_at) in GC: (B) OS, (C) FPS, (D) PPS. (E-G) Poor prognosis associated with high LAIR1 expression (probe 210644_s_at) in GC: (E) OS, (F) FPS, (G) PPS. *, P<0.05; ***, P<0.001. CI, confidence interval; FPS, first progression survival; GC, gastric cancer; HR, hazard ratio; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; OS, overall survival; PPS, post-progression survival; TPM, transcripts per million.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Expressing

Expression and prognostic analysis of LAIR1 in GC. (A) Representative images showing low LAIR1 expression in normal gastric tissue and high expression in GC tissue. Negative staining (IHC scores 1–2), weak staining (IHC scores 3–4), moderate staining (IHC scores 6–9), and strong staining (IHC scores 12). (B) OS based on LAIR1 expression status. (C) PFS based on LAIR1 expression status. (D) LAIR1 protein expression in 16 paired GC tissues (N: adjacent normal; T: tumor). (E) LAIR1 mRNA levels in the same 16 paired tissues. ****, P<0.0001. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GC, gastric cancer; IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; mRNA, messenger RNA; OS, overall survival; PFS, progression-free survival.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Expression and prognostic analysis of LAIR1 in GC. (A) Representative images showing low LAIR1 expression in normal gastric tissue and high expression in GC tissue. Negative staining (IHC scores 1–2), weak staining (IHC scores 3–4), moderate staining (IHC scores 6–9), and strong staining (IHC scores 12). (B) OS based on LAIR1 expression status. (C) PFS based on LAIR1 expression status. (D) LAIR1 protein expression in 16 paired GC tissues (N: adjacent normal; T: tumor). (E) LAIR1 mRNA levels in the same 16 paired tissues. ****, P<0.0001. GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GC, gastric cancer; IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; mRNA, messenger RNA; OS, overall survival; PFS, progression-free survival.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Expressing, Negative Staining, Staining, Immunohistochemistry

LAIR1 expression and its impact on GC cell proliferation. (A) LAIR1 protein levels in various GC cell lines. (B) Statistical analysis of LAIR1 expression across cell lines. (C) Validation of LAIR1 knockdown efficiency via lentivirus in MGC803 cells. (D) Validation of LAIR1 overexpression efficiency in MKN45 cells. (E) Effect of LAIR1 knockdown on cell viability (CCK-8). (F) Effect of LAIR1 overexpression on cell viability (CCK-8). (G) Colony formation after LAIR1 knockdown in MGC803 cells (crystal violet staining). (H) Colony formation after LAIR1 overexpression in MKN45 cells (crystal violet staining). **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant. CCK-8, Cell Counting Kit-8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GC, gastric cancer; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; sh-1, shLAIR1-1; sh-2, shLAIR1-2; shLAIR1, short hairpin RNA targeting LAIR1.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: LAIR1 expression and its impact on GC cell proliferation. (A) LAIR1 protein levels in various GC cell lines. (B) Statistical analysis of LAIR1 expression across cell lines. (C) Validation of LAIR1 knockdown efficiency via lentivirus in MGC803 cells. (D) Validation of LAIR1 overexpression efficiency in MKN45 cells. (E) Effect of LAIR1 knockdown on cell viability (CCK-8). (F) Effect of LAIR1 overexpression on cell viability (CCK-8). (G) Colony formation after LAIR1 knockdown in MGC803 cells (crystal violet staining). (H) Colony formation after LAIR1 overexpression in MKN45 cells (crystal violet staining). **, P<0.01; ***, P<0.001; ****, P<0.0001; ns, not significant. CCK-8, Cell Counting Kit-8; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GC, gastric cancer; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; sh-1, shLAIR1-1; sh-2, shLAIR1-2; shLAIR1, short hairpin RNA targeting LAIR1.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Expressing, Biomarker Discovery, Knockdown, Over Expression, CCK-8 Assay, Staining, Cell Counting, Negative Control, shRNA

Effect of LAIR1 on GC cell migration and invasion. (A) Scratch wound assay in LAIR1-knockdown MGC803 cells. (B) Scratch wound assay in LAIR1-overexpressing MKN45 cells. (C) Transwell invasion assay in LAIR1-knockdown MGC803 cells (crystal violet staining). (D) Transwell invasion assay in LAIR1-overexpressing MKN45 cells (crystal violet staining). ***, P<0.001; ****, P<0.0001. GC, gastric cancer; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; sh-1, shLAIR1-1; sh-2, shLAIR1-2; shLAIR1, short hairpin RNA targeting LAIR1.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Effect of LAIR1 on GC cell migration and invasion. (A) Scratch wound assay in LAIR1-knockdown MGC803 cells. (B) Scratch wound assay in LAIR1-overexpressing MKN45 cells. (C) Transwell invasion assay in LAIR1-knockdown MGC803 cells (crystal violet staining). (D) Transwell invasion assay in LAIR1-overexpressing MKN45 cells (crystal violet staining). ***, P<0.001; ****, P<0.0001. GC, gastric cancer; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; sh-1, shLAIR1-1; sh-2, shLAIR1-2; shLAIR1, short hairpin RNA targeting LAIR1.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Migration, Scratch Wound Assay Assay, Knockdown, Transwell Invasion Assay, Staining, Negative Control, shRNA

Effect of LAIR1 knockdown on subcutaneous tumor growth in nude mice. (A) Tumorigenesis in nude mice following LAIR1 downregulation. (B,C) Tumor progression: significant differences in subcutaneous tumor growth curves (B) and final tumor weights (C). (D) IHC scores for LAIR1 and Ki-67. (E) Representative IHC images for LAIR1. (F) Representative IHC images for Ki-67. **, P<0.01; ****, P<0.0001. IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Effect of LAIR1 knockdown on subcutaneous tumor growth in nude mice. (A) Tumorigenesis in nude mice following LAIR1 downregulation. (B,C) Tumor progression: significant differences in subcutaneous tumor growth curves (B) and final tumor weights (C). (D) IHC scores for LAIR1 and Ki-67. (E) Representative IHC images for LAIR1. (F) Representative IHC images for Ki-67. **, P<0.01; ****, P<0.0001. IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Knockdown, Immunohistochemistry, Negative Control, shRNA

Effect of LAIR1 knockdown on peritoneal metastasis in nude mice. (A) Representative images of peritoneal metastatic nodules. (B) The number of nodules in the peritoneal metastases of nude mice exhibited significant variations. (C) IHC scores for LAIR1, Snail1, N-cadherin, and E-cadherin. (D-G) Representative IHC images for LAIR1 (D), Snail1 (E), N-cadherin (F), and E-cadherin (G). *, P<0.05; **, P<0.01; ****, P<0.0001. IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Effect of LAIR1 knockdown on peritoneal metastasis in nude mice. (A) Representative images of peritoneal metastatic nodules. (B) The number of nodules in the peritoneal metastases of nude mice exhibited significant variations. (C) IHC scores for LAIR1, Snail1, N-cadherin, and E-cadherin. (D-G) Representative IHC images for LAIR1 (D), Snail1 (E), N-cadherin (F), and E-cadherin (G). *, P<0.05; **, P<0.01; ****, P<0.0001. IHC, immunohistochemistry; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Knockdown, Immunohistochemistry, Negative Control, shRNA

Effect of LAIR1 knockdown on lung and lymph node metastasis in nude mice. (A) Gross view of lung metastasis. (B) Lung metastatic nodules visualized by H&E staining. (C) Quantitative analysis of metastatic lung nodules. (D) Gross view of lymph node metastasis. (E) Quantitative analysis of metastatic lymph nodes. **, P<0.01; ****, P<0.0001. H&E, hematoxylin-eosin; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Journal: Translational Cancer Research

Article Title: Unveiling LAIR1: a prognostic biomarker associated with gastric cancer progression and metastasis

doi: 10.21037/tcr-2026-1-0136

Figure Lengend Snippet: Effect of LAIR1 knockdown on lung and lymph node metastasis in nude mice. (A) Gross view of lung metastasis. (B) Lung metastatic nodules visualized by H&E staining. (C) Quantitative analysis of metastatic lung nodules. (D) Gross view of lymph node metastasis. (E) Quantitative analysis of metastatic lymph nodes. **, P<0.01; ****, P<0.0001. H&E, hematoxylin-eosin; LAIR1, leukocyte-associated immunoglobulin-like receptor 1; NC, negative control; shLAIR1, short hairpin RNA targeting LAIR1.

Article Snippet: To modulate LAIR1 expression, lentiviral vectors carrying short hairpin RNA targeting LAIR1 (shLAIR1), a nontargeting scrambled negative control short hairpin RNA (shNC), or a LAIR1 overexpression cassette were constructed and supplied by Shanghai GeneChem Co., Ltd. (Shanghai, China).

Techniques: Knockdown, Staining, Negative Control, shRNA